J Korean Child Neurol Soc Search

CLOSE


Journal of the Korean Child Neurology Society 2003;11(1):47-54.
Published online May 30, 2003.
Mutations of SCN1A in Familial Febrile Seizures.
Joo Mee Kang, Suk Man Roh, Young Hoon Kim, Seung Yun Chung, In Goo Lee, Kyung Tai Whang
Department of Pediatrics, College of Medicine, The Catholic University of Korea, Seoul, Korea. pedkyh@catholic.ac.kr
Abstract
PURPOSE
Febrile seizures affect 2-5% of all children younger than 6 years old. A small proportion of children with febrile seizures later develop epilepsy. Muations in the voltage-gated sodium channel subunit gene SCN1A have been associated with febrile seizures(FSs) in autosomal dominant generalized epilepsy with febrile seizures plus (GEFS+) families and severe myoclonic epilepsy of infancy. The present study assessed the role of SCN1A in familial typical FSs. METHODS: Forty-eight familial FSs were selected throughout a collaborative study of Catholic Child Neurology Research Group. To identify unknown mutations, regions containing the exons for SCN1A gene was performed with two primer(Foward GGAGGGTGAGACGCTGACTC, Reverse CACCTGGAGCTCCCCAGCTG) by touchdown PCR method, and to identify known mutations, regions containing exons of the SCN1A gene were amplified by PCR using suitable primer sets. Ten reported mutations of SCN1A were screened by SNaPshot method. DNA fragments showing variant chromatograms were subsequently sequenced. RESULTS: Among 48 FS patients, thirty(62.5%) showed simple FSs, and eighteen(37.5 %) had complex FS+. Three patients(6.3%) were younger than 12 months old, twenty- nine(60.4%) between 12 and 36 months old, and sixteen(33.3%) older than 36 months old. The ratio of female to male was 0.66:1.0. In the phenotypes of FSs, forty-five patients (93.8%) had generalized tonic-clonic seizures, one patient(2.1%) myoclonic seizures and two patients(4.2%) atonic seizures. In EEG findings of FSs, thirty-eight(79.2%) patients had normal findings, and ten(20.9%) patients had mild aspecific abnormalities. Mutational analysis detected no mutations of SCN1A. CONCLUSION: Our study demonstrated that SCN1A is not frequently involved in common FSs and sugggested any involvement of specific FS genes.
Key Words: Familial febrile seizure, SCN1A, Mutation


ABOUT
ARTICLE CATEGORY

Browse all articles >

BROWSE ARTICLES
EDITORIAL POLICY
AUTHOR INFORMATION
Editorial Office
372, Hangang-daero, Yongsan-gu, Seoul 04323, Republic of Korea 703, Building A, Centreville Asterium Seoul
Tel: +82-2-2138-3303    Fax: +82-2-743-3455    E-mail: editor@annchildneurol.org                

Copyright © 2025 by Korean Child Neurology Society.

Developed in M2PI

Close layer
prev next